CA588031

Overview
NameCA588031
Unique NameCA588031
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length167
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4764 contig Csv1_Contig4764:18..184. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionGS1406 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD1.2 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588031 ID=CA588031|Name=CA588031|organism=Citrus sinensis|type=EST|length=167bp
TGCGTTGAGGCGCAGCAGTTGACTGGACATCTAGGGGTAAAGCACTGTTT
CGGTGCGGGCCGCGAGAGCGGTACCAAATCGAGGCAAACTCTGAATACTA
GATATGACCTCAAAATAATAGGGGTCAAGGTCGGCCAGTGAGACGATGGG
GGATAAGCTTCATCGTC
back to top