CA588031

Overview
NameCA588031
Unique NameCA588031
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length167
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4764 contig Csv1_Contig4764:18..184. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1406 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD1.2 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588031 ID=CA588031|Name=CA588031|organism=Citrus sinensis|type=EST|length=167bp
TGCGTTGAGGCGCAGCAGTTGACTGGACATCTAGGGGTAAAGCACTGTTT
CGGTGCGGGCCGCGAGAGCGGTACCAAATCGAGGCAAACTCTGAATACTA
GATATGACCTCAAAATAATAGGGGTCAAGGTCGGCCAGTGAGACGATGGG
GGATAAGCTTCATCGTC
back to top