CA588036

Overview
NameCA588036
Unique NameCA588036
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length667
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CA588036_ssr55 microsatellite CA588036_ssr55:55..64. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig3210 contig Csv1_Contig3210:597..1263. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1416 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD8.1 5 similar to Ca 2-binding EF hand protein [Glycine max](AAB71227), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588036 ID=CA588036|Name=CA588036|organism=Citrus sinensis|type=EST|length=667bp
GAGCGACTCGGGAACATACGACACCGAGGGAAGGTTAGACACCAAGAGTC
ACGCATATATATATAAAGATGTATTAAGAGGTTAAATTGAACTACTCGCG
TTCATCCTTCTGATATGTGTATGCGTATGTGCATCCAATGGAATCTCATC
AGGTACGCGCCAGTGAATCTCGAAAACATGTTCAGCAAATATGCTCGAAC
GGTTCCTGATAAGTTGACGCTGGGAGAGGTGTGGAACCTGACTGAGGGAA
ATCGTTTAGCATTCGACTTGTTCGGCTGGTTTGTTTCAGGACCCTTGATA
CAATCATATATATCATCTGTATATCACAACGGACTATTAATTGCTCTGCA
TTGTTGCACTCTGATTATGTACAATTGCTTGCAGGGTTGCTGCTAAACTG
GAATGGATTCTTTTGTACATTCTGGCGAGGGATGAAGAAGGCCTCCTGTC
AAAAGAAGCGGTGAGGCGATGTTTCGATGGAAGTCTGTTCGAGTACTGCG
CCAAGATTAACCTGGTTGGTGAGGATAAGATGGGATAGAAGGTAATGCCG
CTGGTCTCTCTGCAATTAGCTTGTTTAAAATGATGTTTAGTTTTGTGTAA
TTGGTATGGNCTTGTAATAAAAGCTAAAGCAATATTGGCATGATGATAAA
ATGGATCTTTTGTTTTA
back to top