CA588044

Overview
NameCA588044
Unique NameCA588044
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length469
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1408 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD2.3 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588044 ID=CA588044|Name=CA588044|organism=Citrus sinensis|type=EST|length=469bp
TTAATACTTGCAATTGTGCAGCAAACGAATTGATCCTGCTGAACTCCTAA
TTTTTTCTGACTCTGGGCTCTAAACCAAGTTTTTTTGGCGGGATTTTTGC
AGGAGTATGGCACTTCGATCAAATGCTTCTCCACGAGGGTGATGCTGCAT
GATGAAGAACCATATTGTTACATTTCTTTGTGGTTTAGTCAACTCTTTGC
TGCTAAATGTTCTGAAGTATCTCTGCCACAGGAGGTTGAATGTCTTGTCA
AAAATAAGCTGAAACTGTGATAAGTCCTACAAAGTCAATACTCAATAGCC
TCCTGCTTTATCATATTAGTGTGGTCGCTTTTAGATAGTCTNTTTTATGG
CGCTTTTTCTTTATTTAGTNACAGACAGTGTGAGGGGTTCTAATAGTTTA
AGCAGAGCACCAAATCCATCTTCTGATTGTATAAATATAATTAAGTTGTT
CATAAAACTTCAGTTTCTG
back to top