CA588045

Overview
NameCA588045
Unique NameCA588045
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length380
Alignments
Feature NameTypeLocationAnalysis
CA588045_ssr304 microsatellite CA588045_ssr304:304..325.
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1596 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD1.1 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588045 ID=CA588045|Name=CA588045|organism=Citrus sinensis|type=EST|length=380bp
CCTCAAAGAGAAGATCATTATCAAGCAGAGGGTTTGGAGGAGTCTTGAGA
GAGCAAAGGGCTAAGCTTTACATTATAGGCAGATGCCTCGTCATGCTCTT
GCTGGCATGATTAATGAGTCTCTGTTTTTTTCCTGCGGGCTTTCTTTTTC
TTTTTCCCTTTTTGGTGGATTGTAAATAGCGGCAGCGGATACGTACTCGG
CAGAGTCTGGAAACAAAATTTGCTACTCACTAAGCTCCTGAGGGCTAGCT
TAGCTATAATATCGATATATATACTAGATATATCTTTTGAATTACAAAGT
TTGATATATATATATATATATATATCAATCAACAAATTAAGCTCTATGCA
TGGTTGCTCATATAACATTCTTTATTCTTT
back to top