CA588049

Overview
NameCA588049
Unique NameCA588049
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length312
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig444 contig Csv1_Contig444:565..850. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1481 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD13.2 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588049 ID=CA588049|Name=CA588049|organism=Citrus sinensis|type=EST|length=312bp
TTGGACAAGTGACTGTTAATTAAGTTCACATTCAGACTTTGTTTGCCTCA
TCTCATTGGTTATCGTTCTCTTCTTTTTGCATTTTATGAGTATCATACAT
ATTTTCCATTTGGTGAGAGAGAATGTTATGTGGTGAGACACTTCAACCAA
GCCAATAAACCTCTGTATTTTCCATTTATTTCAAATGCAGATTTGTGATG
TAACTAATTTAGACATCGGTGCCCCATTAGACTTTCTTTTAGTAATGAGA
ATAGTTACTCTATGCCCACTCACATTAATTTGCAAGCTTTTAAATCCTAA
AATCTTCAACTT
back to top