CA588049

Overview
NameCA588049
Unique NameCA588049
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length312
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig444 contig Csv1_Contig444:565..850. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionGS1481 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD13.2 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588049 ID=CA588049|Name=CA588049|organism=Citrus sinensis|type=EST|length=312bp
TTGGACAAGTGACTGTTAATTAAGTTCACATTCAGACTTTGTTTGCCTCA
TCTCATTGGTTATCGTTCTCTTCTTTTTGCATTTTATGAGTATCATACAT
ATTTTCCATTTGGTGAGAGAGAATGTTATGTGGTGAGACACTTCAACCAA
GCCAATAAACCTCTGTATTTTCCATTTATTTCAAATGCAGATTTGTGATG
TAACTAATTTAGACATCGGTGCCCCATTAGACTTTCTTTTAGTAATGAGA
ATAGTTACTCTATGCCCACTCACATTAATTTGCAAGCTTTTAAATCCTAA
AATCTTCAACTT
back to top