CB250252

Overview
NameCB250252
Unique NameCB250252
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length362
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1987 contig Csv1_Contig1987:734..1095. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionEST0017 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ018 similar to E3 ubiquitin ligase (acc# NP_192260), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250252 ID=CB250252|Name=CB250252|organism=Citrus sinensis|type=EST|length=362bp
ACTTTCCTCACCATTACGGTAGTCATGCAGCTTTGGCGTCTTCTAGTCTT
GGTGGTATGGCAACGATTAGTTTCTTTAATCCACTGATGGGAATGCTAGG
AGGGATGACCTTAGAGAGGATCTTTGGGGGTTCTACTACAAGTTTGTTTA
CGTATCCATCTCAGTCTCTCTTGGTGAGTAACAATCCTAGAATCAGAAGA
CAGGAAATGGAGCTTGATAAGTCTCTTAACAGAGTATCCTTGTTCCTTTT
CTGTTGCCTAGTCCTGTGTCTTCTTTTGTTCTGATCATTTAATCTTTTGG
GTTAGTTCTTTATGTTGTAAAAGCTATGAAAGCCAGTGATTAGATTAACC
ACAGCACAGATG
back to top