CB250254

Overview
NameCB250254
Unique NameCB250254
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length154
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11084 contig Csv1_Contig11084:722..874. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionEST0019 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ020, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250254 ID=CB250254|Name=CB250254|organism=Citrus sinensis|type=EST|length=154bp
ACTTCTGTTATAAACAACGACCAAATCAAACTTCACGGTTAATAAGCAGC
GAATATTTCACCGTTATATATCGATAATGCACTTACTGAATCTTGTATCA
ATTTTCAATTTTCTTGTTGGATTTGATTTTTACCCCGAAAAAAAAAAAAA
AAAA
back to top