CB250286

Overview
NameCB250286
Unique NameCB250286
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length236
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionEST0062 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ080, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250286 ID=CB250286|Name=CB250286|organism=Citrus sinensis|type=EST|length=236bp
TTTAAAGCTGAGGCGACTAAATGATCTAAAGCACCTGTGGCTGTGGGAAC
AAAACTCCAAATTGAACACGGTTTTTCAAAATCTTGAAACTCTATCTGCA
CACTTTTGTCTTAATCTGACAAATCTAATGCCTTCCTCTGCCTCTTTTCG
GTGTCTGACAAAACTGAGGGTATGGGCTTGCGAGCATCTGATAAACTTGG
TAGCATCCTCGGCAGCAAAAAATCTAGTGCAACTCG
back to top