CB250301

Overview
NameCB250301
Unique NameCB250301
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length142
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0081 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ111, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250301 ID=CB250301|Name=CB250301|organism=Citrus sinensis|type=EST|length=142bp
ACAAATTACAACTACTTCCAGAAACACTACTTGTAAGATACATTGGGCCC
TTATCCAAGGTTTACACAAAAAAATTGATAAGTCTTCTACTAGATGCATC
ACATGCAGAGAGCAATTTGGCCCTCCTCTTTCAACTGTATCT
back to top