CB250305

Overview
NameCB250305
Unique NameCB250305
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length222
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionEST0089 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ124 similar to polygalacturonase (acc# NP_191544), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250305 ID=CB250305|Name=CB250305|organism=Citrus sinensis|type=EST|length=222bp
TTCGAAACAATGTCAACATCAATGTCTTTGCCTATTAATTTTTTACCATT
TCTTTTGATTCTCTTCTTTAGTTCATCTTTAGCAATTCCTTTGAGTTACA
ATGTGCTGAGCTTCGGAGCCAGACCCGATGGCCAGACTGACTCAGTAAAA
TCCTTTCTTGCTGCATGGGCTAAAGCCTGTGGCTCGGCCGAGGCCGCAAC
CATTTACGTGCCACCGGGGAGG
back to top