CB250326

Overview
NameCB250326
Unique NameCB250326
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length301
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CB250326_ssr113 microsatellite CB250326_ssr113:113..124.
Csv1_Contig8302 contig Csv1_Contig8302:1990..2289. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionEST0113 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ165, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250326 ID=CB250326|Name=CB250326|organism=Citrus sinensis|type=EST|length=301bp
CCTCTTCCCCCCCCCACAAAAAAAAACCCCATCAGAACACCAAAAAAAAA
ATGATTCGACTCTGCTTTGGTCACTGGATCCGTAGGCATGGTTCGCTTGT
ATCTTATTCTGTCTACTACTACTATTGAAGAGAGGAAGTCAGTCGTGAAT
CTCAGTTCACAATGTGCCATCTTCCGTAGAAAAGGATCTAGAACTCAAAT
GGTGAGGTCTTTTAAATGCGGTGGCGATTTCACATGGGGAATACCTTTTG
TGTTGGATATAAAGATTATGATATGAACTCGTCTCGCGTCATTTAACTTA
G
back to top