CB250336

Overview
NameCB250336
Unique NameCB250336
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length384
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0125 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ187, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250336 ID=CB250336|Name=CB250336|organism=Citrus sinensis|type=EST|length=384bp
ACGAATAAAAACCATAAACAGAAATGCTCAGACGACCACAATTTCAGCAC
CAGTAACACTTCCACCAGCACCAACACAATTCCAGCACCAGTAACACACA
AACACAATCAGCAGCAAGACAATCCCAGAACAGTAACACAGAAACACAAT
CAGCAGCAAACACAACAGAGTCTTGAAGGAACATTTAACGATGCATGAAA
TTAATTTGTATTAATTAAAAATAAATTTATATGAAATTATTTAAATGTTT
AAAAATAAATTCAAACTTATTGAAATTATTTAGAGAGAGCAGACTGCCTT
GAAGGAAGCGGCAGCAGTGGACTTGAAGGAAGCAGCGATGGCTTCTAGAT
CATGAAGCCAAAAGGAAGCAAAGGTCAAAATCGG
back to top