CB250354

Overview
NameCB250354
Unique NameCB250354
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length351
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0148 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ215 similar to expressed Arabidopsis protein (NP_564941), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250354 ID=CB250354|Name=CB250354|organism=Citrus sinensis|type=EST|length=351bp
ACAGACGGCAGAGGTTCAACTTCTTGCCTAAAGGGACTCCGATACCGCCT
TCTGGTCCATCAAAGAGGCACAATTCTGTTGTGGATTCTACTCAAAATTG
AGTAAACATTCATTATCTCTTTTGTATCTGGGGGATTATTGAGATTGTTA
AGTTTTTCGAAATTGTATATGAAAATTCTGATGAGATGAGGTGATCAGAT
TACAATTATGGGGTTCATTTTTTTCTTTTTCTTCTTTTTTCTTCCTTTTT
TTGGGTTTGTGATTTTCTTAGTTATGTATACTGTATAGAAAGATTGTATT
AGTTGATGACAGAGTATATTCATTTTGAAAAAAAAAAAAAAAAAAAAAAA
A
back to top