CB290293

Overview
NameCB290293
Unique NameCB290293
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length515
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CB290293_ssr471 microsatellite CB290293_ssr471:471..482. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig5233 contig Csv1_Contig5233:91..605. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS01_01af02_g1 Washington Navel orange cold acclimated flavedo & albedo cDNA library Citrus sinensis cDNA clone UCRCS01_01af02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB290293 ID=CB290293|Name=CB290293|organism=Citrus sinensis|type=EST|length=515bp
GCACTTGGGTCATTTTGTGGATTCTGATAGTCGAAATGGCGGAGACGACG
GCACCACCACAAGCGGAATCGGCGGTTCAGATCGTTTACACGGAGAGGCC
ACAGGACGAGGAGCCCGAGTCCTTCCACCTCCGTATCCTCTCCTCCGTCC
TCGGCAGTCAGGAGGCTGCAAAGGATGCTCTGTTGTACAGTTATAAGACG
GCTGCCAGTGGATTCTCGGCTAAGCTTACTCCTCAGCAAGTTGATGAGAT
TTCCAAACAACCCGGTGTTCTTCAAGTTGTTCCGAGCAGGACACTTCAGC
TTCATTCCGGACATGGGAAGCTGCACTAGGAGCATGCTAAAATCATTATA
AGCAACCAAGGCCAATATGTATCACTATCAGACAGTGAACTTTCCTTCTG
TATAAAACAGCTATGTACTCATGATACAGTGTTTGACGAGTGCATAACCT
AAATAATCTTCCAAATAAATTATATATATATATGCAGACATCTTTATTTA
AAAAAAAAAAAAAAA
back to top