CB294020

Overview
NameCB294020
Unique NameCB294020
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length742
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CB294020_ssr9 microsatellite CB294020_ssr9:9..24. BLAST: Citrus ESTs to Prunus persica proteins V1
CB294020_ssr417 microsatellite CB294020_ssr417:417..428. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig341 contig Csv1_Contig341:1..742. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS01_06dh05_g1 Washington Navel orange cold acclimated flavedo & albedo cDNA library Citrus sinensis cDNA clone UCRCS01_06dh05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB294020 ID=CB294020|Name=CB294020|organism=Citrus sinensis|type=EST|length=742bp
GCCCTAGGCTCTCTCTCTCTCTCTAAATATCATTTCTTTTTCTTTTCTCA
TTATGCCACAAGTAGATCTTGAAACCCTAGTCTCAGCCTGCGCCGGTGTC
TCTTGCGATAAAAAGATCGCCTGCGAAACCCTGGCCAACGCCATCAACAA
AAACCCCAACCACGCCATCGAGACTAACGACAAGAACCCAAATCAAGAAC
ATCATCATCCTCATCACGATGCTGATGATCATCAGGAACCGGAGATTCCG
CCTGACTTGCCGCCAGATTCCTTTTGGCTGTCGAAGGACGCGGAGTTTGA
CTGGTTTGACCGCAACGCATTCTACGAGCGTAAGGAGTCGCAAAAGGGCC
ACTCCCACTCCAACCCGATTGGCCTGAACCCGAATCCGAGTTCGACTTCT
CAGAGGTTTTCCACTCCGACGACGACGACTTTGAAGACCAAGACTTCGAT
CATTGGCCTGCCCAAGCCGCAGCAGAAGTTTGACCCCAAGTGTAAGAGAC
ACTGTAAAACCAACACCAACTGGTTCCCCAAGCGATCCGGCTCGGTTGGC
AAATCGGATGGTCCCTTGTGCGAACCCTCTTCTCCCAAGGTTTCTTGTAT
CGGTCGGGTCAGATCCAAGAGGGATCGGCGGAGATTGAAGAAGCGACAAG
GTTCCGGTTCGGAGTCGGGGTCTTTGAGGAGTAAATCGGAGAGGAAACAA
AAATCCGGTTTGTTTGCCAGTTTAAAGACCATTTTCCGGTTG
back to top