CB304401

Overview
NameCB304401
Unique NameCB304401
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length344
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_C10 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_C10 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304401 ID=CB304401; Name=CB304401; organism=Citrus sinensis; type=EST; length=344bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTGTAATGGGGTAGACTGG
AAATGAGGTAAGTGCTCAACAATCTCTCGGATGTCAACAACAACTTCCAA
TCCTCCGCATTTAGCAATCCTTTCTCAACTCTAACACTCAGCTTGTCACC
TATATCAACTTTCTTCTTCCAAGTCACGGATCTCCTTCAACCCGAATGAA
TTCGAGTTTTGCTGAAGGTCAACAGCAGTAACATCATTCAGCATTCTATT
AGTTCATGTAGCTCCATTTTGGCTAGCTTCGTCAAATTCGCAGAGACGGC
GGCTGGGTAACATTTCTCTGGATTTCAATGTGAAAAAGTGTCCC
back to top