CB304504

Overview
NameCB304504
Unique NameCB304504
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length430
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:410..839. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_G05 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_G05 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304504 ID=CB304504|Name=CB304504|organism=Citrus sinensis|type=EST|length=430bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCACAATAGTTTTATTTATTAA
TTAAAGAAGACAAAGTACATGAACGCAAACAAAGATAATCTCTTGTATAA
GAGATTTTTGTAAGTGAACTGAACTAAATTGACACTCTTATAATTGATAG
ATAATAACTGTACCCATCTTTTTATTTAATAATATATATCATCATCCAGA
TTGCAGACACTTACCCATAATAATCAGGATTTCTCCCATATTGAGGAATA
ACAATAAGATCAAGATTGTCATTCCCAACATCATCATCAGCAATACTGGA
AGGGGGGAGTAAGTAACCTTCTGACGGATCGCTCATACCTGCGCCAGGAA
GAGTTTTCATATTCTTCAAGTCAAAAAAGATATTTGCTAGCTTCGAGTGC
ACTATATTAAAAAATAAGTACTTGAGCCCC
back to top