CB304512

Overview
NameCB304512
Unique NameCB304512
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length321
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_H07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_H07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304512 ID=CB304512|Name=CB304512|organism=Citrus sinensis|type=EST|length=321bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGCCTAAGTCGCAAAGTTTT
ATTAACCCAAAAGAATATACAAAAATTCTCCCGAGTCTAGAGCAAGATAC
ATCAAGTAAGAGAGTACGGCTGTTGAACATATTCGTATCTCCACAGCATT
TTGAGTTTGCACCCAAACATTGGTCTATTTGGGGTTTGTCCTGCATACAT
CCAATGGTCAACAGGTCAAAGCGCTTCTGAGAACCGTAAATCTGCAGGGC
CAGGTCCCAAAATTCCTTTCTGTTCGCTTATCTTGCCTAGTCCATGAGGT
GCAGGTACTGGGGCTGACAAT
back to top