CB304527

Overview
NameCB304527
Unique NameCB304527
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length442
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_B05 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_B05 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304527 ID=CB304527|Name=CB304527|organism=Citrus sinensis|type=EST|length=442bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTTTCGAAAAAATGGCTTCA
GCTTGACAATCCTCTTTCTGTAATCTCCATAACCATCCCATACCGCTGGG
AATGACTTATAACCCATTTTTTTCAACAAGAGTTAAACAGTACATGGGCT
CATTTGATTTCTTAATTTTCCTAATATTTTCCTTCCAACCAAACAGTGTT
TCAAAAAAAGACACTGTAAAATAAAAAAAGTAAAAAACAAAAAGAAAACC
TATTTAGATTTTTTTTTTCTTTTTCCCAAACACTAGGTGCCATTACCAGT
GAACAAAAAATTTTAAGGAAAAAAAAGGAAAATTACAATATTCATTATTC
GAATTTTCCACTTGAAATCTACACGGCCAGGCCCTAAGGCTTTTTCCCTC
TAACAAAATAGAGTAAATTCAGATAATTGAAAAAAAAAAAAA
back to top