CB304533

Overview
NameCB304533
Unique NameCB304533
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length676
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304533_ssr155 microsatellite CB304533_ssr155:155..166.
Csv1_Contig9189 contig Csv1_Contig9189:711..1386. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_C03 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_C03 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304533 ID=CB304533|Name=CB304533|organism=Citrus sinensis|type=EST|length=676bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGTAAAACACTTGTTTAATT
TATTTATAGACTAAATTCATGAATCTCTACTCATATTACAACACACTTGG
ATCCTTTTATAGACACAGTAAAAGACCCCACAATATTACATTACAGTCAA
CTCTTTTATTTATTTATGGACTAAACTTAAAAGAGCTCTGCTTGTTACAA
CACACTTGAATCCTTTTTATAAGCATACTAAAGGATCCTCCAACAAAACA
TCAATTACAATCATTACACAAACGATAATATTATCTAGAGGTAGTTAAAT
TACACAATACATTGACACAACTATATGTCCAATCCTATGTTTATATTAGA
TAATACCATTAATACACACATCAACTTATCTCACCGTACAATATTCAATT
CGAGTACAAGTTCCAAAACACTTGACCATCAAAAGTATGATCAAAATCCA
CAACATCTCCTCCGTGAAAAACCTCTAAAAGATTAATCTCCAAAACAAGA
GAACCTCCGCGCAACACTTCACGATCATATTTCAATTTGTTCAATGGAAC
TGTAGTTCTAACGCCATGAAAAGGACGATCCTTTTTATCATCACCTATAG
GCTTATAACCATTAGAAGAACCAGATGCAATAACACAAAGCGAGCTAGCG
GGGTCCATATTATTGACACTTGGAGG
back to top