CB304540

Overview
NameCB304540
Unique NameCB304540
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length376
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_D03 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_D03 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304540 ID=CB304540|Name=CB304540|organism=Citrus sinensis|type=EST|length=376bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGAGAGAAACTGATACATAA
TTTTATTCACCAAAGTCACAAGACATAACATTGATCATTAAAAAAAAAAA
TTAAAGACACATCCAGCAAAAGGCTAATAATATTATAAGCACAGTTGCTC
AGTTTATAGATGGCGGGGGGTACATGCCCTCCACTGCCAGCCAATTTCTG
TCTCTGCCAATTTCAAAATTAAAGCAAAGCAAAAACCACCGTACTAAAAT
ACATAATCAAAATATAAAACGCCAAAGGGCCATTTCAAAATAAGCCCTTT
GTCATTTTGATACCAAATTCAACTAATTAACGCTATTACACTCATTATTT
TATACTTGAAAATGTGAAAAAAAAAA
back to top