CB304554

Overview
NameCB304554
Unique NameCB304554
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length160
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_E05 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_E05 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304554 ID=CB304554|Name=CB304554|organism=Citrus sinensis|type=EST|length=160bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACGTTACATAATGGGAGCTG
CCCTTTGATCATATGATATAATAGAAACGGAATCTTCCAAACAAAAGTCT
CAAATCTTATTAACGAAAATAAACGGCAGTAAGGGTATTTGAAAGATAGA
AAAAAAAAAA
back to top