CB304569

Overview
NameCB304569
Unique NameCB304569
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length133
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IVaR_G03 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IVaR_G03 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304569 ID=CB304569|Name=CB304569|organism=Citrus sinensis|type=EST|length=133bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGTTGCGGTTTCTTCTTTTA
AGAGTCTTTAGATTATAACAGCAAAGCAGAGGAATGAAAGGAAATCTAAG
CGGAGATTTTTGTTTGTATGGACTGTGAATCCC
back to top