CB304634

Overview
NameCB304634
Unique NameCB304634
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length656
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IaR_F12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IaR_F12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304634 ID=CB304634|Name=CB304634|organism=Citrus sinensis|type=EST|length=656bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAGAACATCAGCTCTAATAAA
TAAAGGAAAAAAAAACTACAATAATGGTTGGATAACCATGTTCATAATAT
CAAAAAAGTCAAAAAGAAGAGCAATGAAAGTAAGCAAACACTTTGAAGAC
TATATTCAGTTTCGTATGCTATGGAGTCATAATTTTGACATAGTTTCCTG
ATTATACCACACATTTGTTTTGAGGGCACAAGATTTCCTGACAACATCAC
AATGTACAAAGATCAATGGCCTACCACAGACCTTGATTTTCTTTAATCCT
CTTCAACCTCATCCAGAAACCAGTTTCACAATGATAGTGACGAGATTCAA
AAGAATAAGCGGCAGTCTCATGAACTGGCATGCATGTATAAGCCCAATGA
CCTGCCCTTTTAGTGTACTTCTTCCACCTGCTTGCAGTTCTGCCAAAGTC
CACCTTCTTGGGGCTAGGAAGCGATCCTCATTTAGAATCGCGAATGCATT
AGCCAAAAGCAGAAGGCCTTCCAGAAAAGTCCAGAAACCCATTCTTCAGT
AACAAAACTTAACCCAGAAGATGATAATTTCAAAGAAGAAACGGCTTTCC
TCTCAACGGAAGAACTCAGAATTAAACCCTTTCTGATTTCACCAAATAGA
AAACGA
back to top