CB304635

Overview
NameCB304635
Unique NameCB304635
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length181
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13178 contig Csv1_Contig13178:285..465. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IaR_G01 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IaR_G01 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304635 ID=CB304635|Name=CB304635|organism=Citrus sinensis|type=EST|length=181bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTTTCTAGGATGTGTTGCT
CACACACTTATTTATGAATTGATAACGGCGTATAAGTTATTCTTCGACTC
TTTCTCAGCCCCTTGAACAGTATTCTCTGCAACATGATTTCTATCAAATC
ACAAAGGCACATTTTGTGATTTGGTAGTTGC
back to top