CB304653

Overview
NameCB304653
Unique NameCB304653
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length400
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13346 contig Csv1_Contig13346:516..915. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIIaR_A04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIIaR_A04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304653 ID=CB304653|Name=CB304653|organism=Citrus sinensis|type=EST|length=400bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAACAAAGTCATGCTTTATTTG
AACCATTATTTGTTCGGTGGTTAGATAAATGCTGGACATCTTTCTACGTC
TACAAATGGAATGAAAGTCCTATTTATTTGATGAATAATTACATTCTAGT
GTTTAGCTTTACTTTAGTCTTCCAGGAGCTCCACCAAATCCAATCAAGAA
AAATCTATTAGCCTTGCGAGGATCTAGTGTCATCTTCTGTAATATCTACT
GCTTTTCATCAAGGTAAGGTAGCCTTCTATTCTGAGGAACTTCTTGTCAT
TTGTCATGCCGTGCCGGTGCTGATTCTGTAGTATTCCCCATTTACATAGC
ATTTAGCATACTCCTTGCCTTCAAAAAATCTCCATATCAATAGAATTACC
back to top