CB304670

Overview
NameCB304670
Unique NameCB304670
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length483
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3639 contig Csv1_Contig3639:832..1314. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIIaR_B12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIIaR_B12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304670 ID=CB304670|Name=CB304670|organism=Citrus sinensis|type=EST|length=483bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGCCAAATAATGCACATTT
CATATGTAAAATCAAGTCAAATTTCAGGCCTACATATTCGTTTCTTGTCT
CAATTATAGTTTTCAGAACATGGATGAAAACTTAGTGACAGACAACTCAA
GCTACCCTTCATCTGGCAAGCGTCACAGAGATGGAATTATCAAAATGCCA
GATGCAAGGATCCTGTTCTGAAAACCTTCGAACAAAAGTCAAACCAATGC
AGCTCCAAAATTTCCGCGGCTCATGATGATAGTTAGAAATTATAACAAGG
CAACATGCATTTCGCATATGCAAAAACAAATAATCCTGAATCTGTCTTTG
AAGCCGATGATTTGATAGCACTGATAAGCAGCCTTATAACAACACAAATA
ACTAACGATAAAATCAAAACAACTGAAAACTAGTTTCTGCCACAGCTCAA
AATTGACGCCTTGATGGCCTTGCTTCAGCCACT
back to top