CB304732

Overview
NameCB304732
Unique NameCB304732
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length312
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIaR_A11 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIaR_A11 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304732 ID=CB304732; Name=CB304732; organism=Citrus sinensis; type=EST; length=312bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTATAACAACGTATATTTTAA
CAAAGAAATACGAGTATATGAGGGGCATCAATTAAACAACCTGGTAAAAC
CGATGAGAACAACTAAATCATACCATATTTGTGTCATTCAATAAACAAAG
ATTACAATTCCAACCAACCAATATGATATAATTGAAGTTTGAATACATGT
ACACTTTATATTTGCAGATCTGTCAAGGCCTCCTTTTCATCTTCTTCAGA
CTTCAATATCCAAAATCCCCCTCTGCAATTTCTCTATATCAAAACTTTGT
TCGTCTGTTTGG
back to top