CB304789

Overview
NameCB304789
Unique NameCB304789
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length595
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13390 contig Csv1_Contig13390:164..758. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIaR_H07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIaR_H07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304789 ID=CB304789|Name=CB304789|organism=Citrus sinensis|type=EST|length=595bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAAGAAGCATAAACTTTATGA
TACATAAATATATAGAAAAATAACATTGTTTATACACTATTGTAAAGTTT
ATTCATCAACAGCTTTGTTTACAACTCCATCTATAGACAAGATGCAACTG
AAAGAGTATCTGATAATATAGGAGAGCTCATACAATCTAGAGGAAAAAGC
ATAGACATGATACAATTTAATAGGCCTTACACAACACTAAGCAGGCAATG
CGAAGCTCAACTGCGTCCAGTGTGGAGGATCCATCACAGCGCAGATGTCT
CTTTTCTCAAAATTGGCAACCTTTTCATTGCATGAAGGGCAGTAGTGATA
CTTATGCCAAAGGCAGTCCATTGAAGGGCAAAGAAAGCATATGCCAAGAA
AGAATGGCATCATACAACCAACAACAGCTGCCGAACTTGGCTTTGATATG
ACTTGGGTAACGCCGGAATTGCCACAGTAAACGCAGCTGAAGGGAGCGGG
AGTATCCCGATAAATCGTTTGTTGAATCGGAATTCCCATGGGATCGCCGA
GTATGGCGTTTGGCGGGATCTCTCCCTTTTGGTACGGATTCTGTC
back to top