CB304790

Overview
NameCB304790
Unique NameCB304790
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length201
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IIaR_H10 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IIaR_H10 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304790 ID=CB304790|Name=CB304790|organism=Citrus sinensis|type=EST|length=201bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGCAAAAATTGACAAACTAA
GATTCAATCCTATTTTGGATTTAAAGTAATTTGTACAAGAGTATTCACCA
ATCTAAGTACTACTAGTGTGTCCCCATTTCTGCAAATCTTCTTGCAGCTT
TGTGAATATTTCTCCACAACCACAACCAGCGAAAAACAGGAAACCCCCCC
C
back to top