CB304855

Overview
NameCB304855
Unique NameCB304855
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length630
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_B03 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_B03 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304855 ID=CB304855|Name=CB304855|organism=Citrus sinensis|type=EST|length=630bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTAGCAGAAAGGAGCACGACGGCT
ACTACTTCAAGACCAAGCGTAACAACAATAGCACATTAAAGAGGAGTGTA
AGAAATTAATGAGTAAAAAATCAGACAAAAATATCTAAAAGAAAACATCT
AATGCTTGTGGGCTCGGTAAGATTCAAAAGCAGCAAAGATCACGGTGGAA
TCCTTTTGAAATCAAACCACAAGCCATTCTGAGTAGAGCAATCTTCAGAC
GAACTTAGAGAACGACAGAACATTTGTGATTAAAACTAACCAAAGAACGC
TTTTGAATACATGGATGTTCCCAGTCGTTACAGTGACTTGACCATGCAGA
GAAAACGAGAGAGATGGTTGAGAGAACTTCAAAATGCCAGTCTACACAAG
ACCAAGTACCCACAGAACCCAGTTCCCCCCACACAATTAAATCAAGACAT
TTTCCCGTACAAACACATAGGTAGAGAAAAAAAAGAGTGCCTGCAGTTGG
TTTACAACATTTCTTGTGATCTTCTCACACAGCGGCCTACTTTCTTCTTG
AAGTCATCTCTCCTGTCTCTCCATTCTTTTGCAGCTTCNNNTTTGCAGNT
NNTCATCATTAGGACTGGAANNNTTGATAT
back to top