CB304869

Overview
NameCB304869
Unique NameCB304869
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length664
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CB304869_ssr588 microsatellite CB304869_ssr588:588..597. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig5863 contig Csv1_Contig5863:420..1083. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of CB304869 vs. ExPASy Swiss-Prot
Match: Y1089_ARATH (Uncharacterised protein At1g10890 OS=Arabidopsis thaliana GN=At1g10890 PE=2 SV=1)

HSP 1 Score: 77.411 bits (189), Expect = 7.278e-14
Identity = 48/96 (50.00%), Postives = 56/96 (58.33%), Query Frame = -3
Query:   30 LIEEETARRVEEAIRKKVEESLNSEEIKMEIQRRLEEGRKRLLDEVESQXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXENRRKVEESQRREAEE 317
            LIEEET +RVEEAIRKKVEESL SE+IKMEI   LEEGRKRL +EV +Q                               EN ++VEE+QR+EA E
Sbjct:  128 LIEEETVKRVEEAIRKKVEESLQSEKIKMEILTLLEEGRKRLNEEVAAQLEEEKEASLIEAKEKEEREQQEKEERERIAEENLKRVEEAQRKEAME 223          
The following BLAST results are available for this feature:
BLAST of CB304869 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
Y1089_ARATH7.278e-1450.00Uncharacterised protein At1g10890 OS=Arabidopsis t... [more]
back to top
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_C10 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_C10 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304869 ID=CB304869|Name=CB304869|organism=Citrus sinensis|type=EST|length=664bp
TTTTNNNTTTTTTTTTTTTTTTTTTTTTTCTCCTCAGCTTCCCTTCTTTG
AGATTCTTCCACCTTCCTCCTGTTCTCTTCGAGCATTTTCTCCAATTCTT
CTTTTTCTTTTCGAGCTTGTTCCTCCTTTCTTCTAGCCTCAGTAAGAGCA
GCTTCCTTTTCTTTCTCAAGCTGAGATTCAACTTCATCGAGAAGCCTCTT
CCTCCCCTCCTCCAATCGCCTTTGTATTTCCATCTTTATCTCCTCAGAGT
TCAAGCTCTCTTCAACTTTCTTCCTAATCGCCTCTTCCACTCTCCTAGCA
GTCTCTTCCTCTATCAGTTTCAGTTCTGCTTCTTGTTGACGCCTTTTTTT
CTCTTCCTCTTCTTTCCTCAATTTTTCACTTGCACTTTTCCGCTCTAATG
ACCCAAGACTTGGACTCGAAGATTTATGGGCAGCAGACAATGAAGAACTC
CTACTTCTTTGCCTCTTATACCGCCTTGGAGTTGGCGAACGGCTTTTATG
CCTTCTTGGAGAAGGAGAACGACCTTTACGGCGTCGTGGAGAAATTGAGC
GGCTTTTTTTTCTGCTATAAGAATATGGCGACCGGCTTCTCTCTCTCCGG
CTCCTCCTGCTATACCTGGGTGATGGTGAATGTCTCCTCCTATATGATGG
GGAACGCGAACGTG
back to top