CB304871

Overview
NameCB304871
Unique NameCB304871
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length443
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12201 contig Csv1_Contig12201:35..478. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_C12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_C12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304871 ID=CB304871|Name=CB304871|organism=Citrus sinensis|type=EST|length=443bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGCTTGCATAAATACAAACG
GACATGGAATTCATTACTTGCGGATTACATATCTTGTCTACAAACAAACA
TGAAAAAAAGACCATTTTAACTACATAAGGCTCCACAAAAAGATTGAATG
TACATCACCAAGGCACAAACCGGTCCATAAGCAAACAGATAGTAGTCTCT
GATATTGTACTTTCATCTTCAACCTCTTTGGTGCTCTCCTTTTTATCTTC
TTTCCCATGTACTTGTTCTTTCTTAGCTCTCAACACAAACGGCTTCCTGC
CTTTAACCTTCTCTCCCAGCTTCGCAAGCTCACCCATGCATATCTCCACA
ACTGCCGACATTTTCACTGCTATAACCAAAAACCCACTTGGAATTTTCAG
CTGGCTCTCTCTTTCTTGTTGATCTTTCTTTGTTGAATATCCC
back to top