CB304889

Overview
NameCB304889
Unique NameCB304889
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length396
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304889_ssr350 microsatellite CB304889_ssr350:350..361.
CB304889_ssr371 microsatellite CB304889_ssr371:371..394.
Properties
Property NameValue
Genbank descriptionFLAVEDO0002_IaR_F02 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0002_IaR_F02 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304889 ID=CB304889|Name=CB304889|organism=Citrus sinensis|type=EST|length=396bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACAGCGTTGTTCACTCACAA
AACTTTATTACTTAATGGTAAACTATGATATACACTGTACACCAAAACCT
GTTGAAGTGTCGGTCATCAGACTCTATAAGCAGTCATCACTAAAGCTGGC
AAAACGGGTCATCGGGTCGTGTTCGTGTCGTGTCAGCTTCGTGTCGTGTC
AAATTTAGGTCGACCCAAACCCGACCCATTTAATAATCGTGTCAAAATAT
TGAGACCCAAACCCGACACGGAAAAATAATCGGGTTACCCAATAACCCGT
TTAATATCTATATATTAAATAAAAATTACATCAAATATTTACACACTATC
ATACATACATATGTACATAAATACATACATACATACATACATACCC
back to top