CB305077

Overview
NameCB305077
Unique NameCB305077
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length625
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12286 contig Csv1_Contig12286:421..1044. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_G04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_G04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305077 ID=CB305077|Name=CB305077|organism=Citrus sinensis|type=EST|length=625bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCGACCCAATAATGCTTTGAA
TTTTCTCAACTTAGGACAGGTCCCTTACAAATGTCAACATAGTGTTGAAC
ACAACCAGCTACAGGAGTCGTAGAGAAAATGAAAGAAATGGACATAAAAG
TCCAACAAAGGATCACATAAATCACACAGTTCCAATTACTAACAACAGTA
ATGGCATTAATATTGGGCTAGACCATAACCCACATTGGTCCACAGCAGAC
TGTGAGTCGCCCGGGTTTATTCACACTCGTCTAGCAAAGGGAAACGAGAG
TTTCAATAACATATGGTACAGAGGTAACACTATTTCTGTCTAATACACAT
GGCTAAGCCTCATAAGAACAAGTTCAGATCATAATTGGTTGGTATCCATC
TTCGTACTTATTCCTACGCCTGTAACCCACAGTGGCAGCAATGACAGCAA
CTCCGGCTAAAACAAATGCTCCCCAAACAAAAGCAGAATGGTTTATATCA
CTGTCCATCTTGTTGAAAACATCTAAGAATGAACTGGACTCGGGCACCCT
GTCTGCAACCAAAATGTAGAAAAGCCCCATGACTCCTGTGTGTTCGCGGG
AGCTACTATAGCTAGATTCCACAAT
back to top