CB417313

Overview
NameCB417313
Unique NameCB417313
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length222
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12994 contig Csv1_Contig12994:996..1217. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Mature peel (flavedo) cDNA subtraction librarycdna_library
Properties
Property NameValue
Genbank descriptionEST0389 Mature peel (flavedo) cDNA subtraction library Citrus sinensis cDNA clone 6P034 similar to unknown Arabidopsis protein (acc# AAO44003), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB417313 ID=CB417313|Name=CB417313|organism=Citrus sinensis|type=EST|length=222bp
CAGAAAGCAAAGAAAGAGCAAGTTCAAGTGAGAAGCAAAAACGATGAGGC
GAATTCCGCGAATTAAGTTCCCACAGAGACACCCCAAATCATCAGCCTCA
GGCTCTGTTTCACAAACCCAATCTGCATCAAATCAAAATCTCAGTGCTAG
ATCAAGCTCAGATGTCCCAGCAGCACCTGCAAACACTGCTGTAGGAGGAA
AAGCTTCTCTTCAGCCAAAACG
back to top