CB610493

Overview
NameCB610493
Unique NameCB610493
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length601
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig385 contig Csv1_Contig385:1..601. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
Mature Albedocdna_library
Properties
Property NameValue
Genbank descriptionALBEDO0003_IaF_G03 Mature Albedo Citrus sinensis cDNA clone ALBEDO0003_IaF_G03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB610493 ID=CB610493|Name=CB610493|organism=Citrus sinensis|type=EST|length=601bp
GGGGGTCAAATTTTTCATTTTAATCCTGCCTTTTTCGGCCCTAATGGATT
TGGGTACACTAATAATTTTATAATGCACACTGATGGCACTGCAAATACCA
ATGGACATACTACTACTAGAAGGAAGAGGAATGGTTATAGTCAAGGGAAA
CGAAGGATGAATTGTAGAACAACAACCAGAAGAAGATCGCAAACAACTAT
TTTTCATTGAAAAGAAAAGAAGAGGAACAGAGTCATTTTAAGGGAAAATG
TCAGGAGTTATTCACAAGATCGGAGAAGCCCTTCACATGGGAGGAGGGCA
AAAGGAGGAGGACAAGCACAAGGGAGAGCACCATAGTGGGGACCACCACA
CTACTGATGTCCACCATCAGCAGCAGTATCACGGCGGCGAACACAAGGAG
GGCTTGGTGGACAAGATCAAGCAGCAGATCCCCGGTGTCGGCACTACTGA
TGTTCACCATCAGCAGCAGCATCACGGCGGGGAACACAAGGAGGGCGAAC
ACAAGGAGGGCTTGGTGGACAAGATCAAGCAGAAGATCCCCGGTGTCGGC
GGCGGCGAGGGCGCCGCCCACGGAAAAAAAAAAAAAAAAAAAAAAAAAAA
A
back to top