CF417074

Overview
NameCF417074
Unique NameCF417074
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length357
Properties
Property NameValue
Genbank descriptionUSDA-FP_115000-004 Citrus sinensis: Insect-damaged immature leaves/stems from field collected Valencia orange Citrus sinensis cDNA clone IDFL-001_A7 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF417074 ID=CF417074|Name=CF417074|organism=Citrus sinensis|type=EST|length=357bp
AAGATAACATCACTTGGATCAAAGGAACGTGCCCAATCCATGAAGTGGGG
AGGAAAATGAATGGTGTTATAGAGAAGTTCCAGATTTTGCAGAGTGAGGG
TGATGTTCTGTGCACTTCCCGGTTGGCGAGAGCTGGTCTGATTAAGGAGA
GTTTTCAGTCTTCTTCAGGAGGCGATTCCACCGNCNATGGGAACCCCNTT
TTGGCGAAGATTTTGATGCCTTCTTTAGTCGCATGAGCGGCAGCTCCTCT
GGTACCTGGGTACTCCGTAAAGGTGACCGACCTCCGTCGTTCCAGGCGGC
AAAGGCAAATTGCCCGTCTCCTCTCTTGGGGGGTCCTCGGGGGTACCCCG
ACTACCC
back to top