CF417214

Overview
NameCF417214
Unique NameCF417214
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length404
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7955 contig Csv1_Contig7955:608..1011. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_115000-144 Citrus sinensis: Insect-damaged immature leaves/stems from field collected Valencia orange Citrus sinensis cDNA clone IDFL-002_G1 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF417214 ID=CF417214|Name=CF417214|organism=Citrus sinensis|type=EST|length=404bp
CTCGTTTGTGTTCCTTTTTGCTTCTGTGTGGATGGCTTTTGACTCCAGAC
AAGCCAAGGCTCTTGGCAGAGTTACCGTATGCATTGTCATTGGAACAGTG
TTGGGTCTTCTGGTTTTTGTCTCGACAACTGTTACTGCTCAAAAGGGCTA
TGCCGGAGCTGGGCTCAACCCGGCAAGATGTTTGGGCCCAGCACTCGTTA
GAGGAGGCCATCTCTGGGATCGCCACTGGGTTTTCTGGGCCGGGCCGGCT
ATCGCTTGCGTGGCATTTGCTTTGTACACTAAGGTCATTCCAAGTCAGAA
TTTGCACACCATCAAGTGATGTAGCTTGAATTTCAATCACCCTTATTGGC
TTCTTAGGATTAATTGAAGGTGTTTCATGTTTTAAGGAATTAAAAAGTGA
AATA
back to top