CF503802

Overview
NameCF503802
Unique NameCF503802
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length479
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-288 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_A01 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503802 ID=CF503802|Name=CF503802|organism=Citrus sinensis|type=EST|length=479bp
AGATACAAGTTTGGAAGCCAAGTAGAAGCCTTCTTTGTGATACTAACTGC
ATTTCAGTTTCACTTGTTATTCTATTGCACCTCGTCCTCTTCCTAATATC
CTAGCTTTGGGTATAGGTAATTACTCCTTGTCTTTAACTCCCTTTATGTT
TTCCTTGCAAAACTAGTGAGTTTATTTTCCTATGAAAGCTTGAAATTGTA
GTTTTTATGGACTATATAGAAGTGAGCATTATCTGGAGAAATTTAATAGG
TTGCACTTTATACTTATCTAATTATTTAAATCACAAGAAAGTTTCCAGCC
TCAAAACGATTATATGAAATTTGTAATTGTTTAGTGTAATTCTGTTATTT
TATCTTTGGAGGTGTTTCAGATATTTTTCATAGTCAACGTGTGATGGACT
CTAAGTTTCAACACTTGGGAATTGGGTTTTAGGCTGTGGCTTAAAATTGA
TGGGACTCGTCATCATTTTTTTTTTCAGT
back to top