CF503811

Overview
NameCF503811
Unique NameCF503811
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length490
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-297 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_A10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503811 ID=CF503811|Name=CF503811|organism=Citrus sinensis|type=EST|length=490bp
GGAAAGTGCAGAATGTTAGTTGAAATTGCTAGAAATTCATTGGAAGAGGG
GAAACATCCTTATTATGGAATTGAGGCATGCAATGAAGTTTTGGAGGGGC
ATCTCAGTGGCATTGGACCCATGCTGAGGCATGAATGTCTTTGCATACGT
GCCGCCTTGTTGCTTAAGCGCAAGTGGAAAAATGATGCCCAAATGGCCAT
AAGAGATTGTTACAATGCTCGGCGGATTGACAGTTCTTCCTTTAGAGCTC
ACCTCTACATGTCTGAAGCTCTAGAGCAGCTTTGCAAATATAAGGAAGCT
TTAGATTTTGCCATAGCCGCCCAATGTCTGGACCCATCCAATTCTGTGAT
GGCAGAAAAGGTCGAAAATATAAAGAAGCATATTGCTGCAGCCGAAACAG
AGAAAAATAATAAGGCAAATGATGGAGGAGCAAGGTCCGAACCTCCAACT
GGAAGAGTACTTTCACTGAGTGATATAATCTACCGGTCCA
back to top