CF503819

Overview
NameCF503819
Unique NameCF503819
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length282
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-306 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_B07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503819 ID=CF503819|Name=CF503819|organism=Citrus sinensis|type=EST|length=282bp
AAGGAAAGCAATTGGGTCATCAGAAGCAATTTGTTCTGAGTTGCCAGATG
AATTCTAAAGCTTGTAATGTGATACCACCAAGGCAATCTGCCAATTATAA
GCCAAACATTTGGAAATATGATTTCATTCAATCCCTTCACAGCAAATATA
AGGAAGAAGGATGTAGAAGCCGAGCCGAGAAGCTAACGAACGATGTGAAG
CAAATGTTTCTTGAAGCAGCTGACCTTTTAGCCAAGCTGGAGCTCATTGA
TAGAATCTGTAAACTAGGCCTGTCCTATCTCT
back to top