CF503826

Overview
NameCF503826
Unique NameCF503826
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length397
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CF503826_ssr51 microsatellite CF503826_ssr51:51..64. BLAST: Citrus ESTs to Prunus persica proteins V1
CF503826_ssr259 microsatellite CF503826_ssr259:259..273. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2487 contig Csv1_Contig2487:111..507. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-313 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-10_C02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503826 ID=CF503826|Name=CF503826|organism=Citrus sinensis|type=EST|length=397bp
CCCCCACCTCACTCACTCTTCCATCATCATTTCCATCCATTTGAAATCAC
CTCTCTCTCTCTCTCGAAACTCAACAGATTCAACCACAAGAGTCGAGAAT
TCACTAACAAGAAAAGAAAAAATTCACGACTATGGCTCTAGAAGCTCTAA
ACTCCCCTACAACAAGCACCCACAATCATCATCCGTTTAGATACGAAGAC
TCATGGACTAAAAGAAGGCGCTCAAAACGACCCCGTACCGACGAGTCCCC
ACAACTACCAGCAGCAGCAGCAGCTCCCACGGAAGAAGAGTACATGGCTC
TCTGTCTCATCATGCTCGCCCGCGGGACCACCACCGCCAACACCGCTCCG
GCCGAAAGAACCCCAACCCTGGCGCCGGAACAGAAGCCGCTGGATCA
back to top