CF503943

Overview
NameCF503943
Unique NameCF503943
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length560
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-431 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-11_E08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF503943 ID=CF503943|Name=CF503943|organism=Citrus sinensis|type=EST|length=560bp
AACCAATTCCACATGTAGGCGGAAAATGGCTTCAAGGTTTCATGGTAAAG
CTGAAGACAAGAAGCTCGAAACCAATCCCACAGGTAGGCGGAAAATGGCT
TCAAGGTAGCCGTGGTAAAGCCTGAAGACAAGAAGCCTCGAAACCAATTC
CAAATGTTGGTGAAAATTGGCTTCAAGGTGTCGTGGTAAAGCTGAAGGGA
AGCACCCGATAAACAATCTGCCATACTGATGATACACAACAATAACAACG
GCACAAGGCCATGAGATGTATAAAATGATATGACTACTGGAGCCTTGAAG
AAAAGTGGAGACCAGCGAGATGGCAGAAAGAGATCCAGAGGTAATAGCAA
TAATGCCAGAGCGTTTGGTGGAATTTTCTTGTTGAGCTAGAGACTTGATA
TCAGTTGCGAAGGCGAAGCAGTATATTGCTTGGGACACAAGAAAACTCCA
CATATTTAGTGTATGTGTTTTGAATATGGGCTCTGTTGTGCCTTGATCAT
TGGCTCCCAGGATACCAATGAGGACTGGAATCAGGTATGCAAAAATGAAC
TGGTACGGCA
back to top