CF504036

Overview
NameCF504036
Unique NameCF504036
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length397
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10543 contig Csv1_Contig10543:516..912. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-524 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-12_F04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504036 ID=CF504036|Name=CF504036|organism=Citrus sinensis|type=EST|length=397bp
GTTTGATACAACTAAAAACAGGTTTTTGGCTGCTGGTGATGATTTCTCTA
TTAAATTCTGGGATATGGACAATGTGCAACTTTTGACTAGTATTGATGCT
GATGGAGGTCTTCCAGCAAGCCCTCGAATCCGCTTTAACAAGGATGGCTG
TCTCTTGGCTGTTTCTACCAATGATAATGGAATCAAGATTTTGGCAACTT
CAGATGGCATTCGTTTGCTGCGTACATTTGAGAATCTTTCTTATGATGCA
TCACGAACATCTGAAAACTCGAAGCCTACGATAAGCCCAATTTCAGCTGC
AGCAGCTGCTGCTGCAACTAGTGCTGGACTTGCAGACAGAGCAGCTTCTA
TGGTTTCAATTCCAGGAATGAATGGAGATGTACGGAGCTTGGCGGAT
back to top