CF504132

Overview
NameCF504132
Unique NameCF504132
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length368
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4425 contig Csv1_Contig4425:444..811. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-620 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_B12 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504132 ID=CF504132|Name=CF504132|organism=Citrus sinensis|type=EST|length=368bp
GTTTAGTGGTAAAAGTGTGATTCGTTCAATTAATCCCCTTAATAGTTAAG
GGGTCCTTCAGTTTAATTGATATTTCAATCAAAAACTTTATTTCTTAAAA
GGATTCAATTTTAATCCTTTCACTCTCAAATTTAAATAAAAGATTCGGAG
AAAAATATCCGTTCTCGTGATTTGTATCCAAGAGTCAATTCGAAATTGAC
AATTTGGATTATGAAATTGCGAAACATAATTTTGTTTTTTGTTTTTGAAT
TGGATCAATACTTCCAATTTTTTAAGTATAAGTAAAGGATCCATGGATAA
AGATAGAAAAGTCTAGTTCGAATCGTAACTAAATCTTCAATTTTGGTTTT
TTATAGGTTAGATTGAAG
back to top