CF504137

Overview
NameCF504137
Unique NameCF504137
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length360
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1937 contig Csv1_Contig1937:740..1099. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-625 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_C08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504137 ID=CF504137|Name=CF504137|organism=Citrus sinensis|type=EST|length=360bp
CGGGCTGCAGGGGACGAAAGGATTTTGCTTTGGCAGAAGGAGATTGAGGA
GGCTGAGAAGGTGATTGCTGGATTGAAAGACAAGACTTTGGATGGGGTGA
ATGGGACTGCGAGGGATGTTAAGCTAAATGGTGACGGCGAGGAAGAGGAC
AGTAGGTTGAACTGGCAGTTGCCACTTGCGGCTGTTACTGCCGCTGCTGT
GGTTTGTGTTTGCTATGCTAGGTGCAGGTGATTGCACCCTGCCCAAAATA
GAGAGCAAGAGATAAAATTGAAGAGGTGACTGCACGACCTTAGATTACAA
ATATGTGTTAAACTTTCAATTTTGATTGATAGGATTTATGTCTTTGCTTG
GCTATATTTT
back to top