CF504138

Overview
NameCF504138
Unique NameCF504138
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length319
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1459 contig Csv1_Contig1459:18..335. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-626 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_C09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504138 ID=CF504138|Name=CF504138|organism=Citrus sinensis|type=EST|length=319bp
GCCTAGAGATCTTTTCTAGCCATGACACTTCAACCACTGATTTTTTATGC
TTCCCTCTTCGTCTTGTCCGCCCTAGTGCTGAAAGCCATCAAACACTCAC
GGCGACTGCCACCGAGCCCGTGGGCCTTGCCGATCGTCGGGCACCTCCAT
CTCCTCGGCCCTTCCCTTCACCATTCTTTTCACAAGCTTTCAACTCGTTA
TGGCCCCTTGATGTCCGTGCGCATAGGCTCTGTCCTAGGTGTGTGTAACT
TCTTGTCCTGATGTAACCAAAGAGCTTCTCAAAACAAATGATGTTACTTT
TACCGGCCGGAAAAGCTCT
back to top