CF504139

Overview
NameCF504139
Unique NameCF504139
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length220
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-627 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_C10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504139 ID=CF504139|Name=CF504139|organism=Citrus sinensis|type=EST|length=220bp
CGGCACCAAGTATGCTAAAGGTCTTGTATCGGAGGTCTCCGAGTTTCTCT
TTGGCTCGGGTTTTGCCATTGCTGAAGGCCCTCTTTGGATGGGAAGGCGC
ATGGCTGTGGCTCCATCTCTTCACAAGAAATACTTATCTGTGATAGTTGA
CTGTGTATTTTGTAAATGTGCTGAGAGATTGGTAGAGAGGCTGCAAACTG
ACCCTCTAAATGGAACTGCT
back to top