CF504150

Overview
NameCF504150
Unique NameCF504150
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length372
Properties
Property NameValue
Genbank descriptionUSDA-FP_119000-638 Immature Ovaries from field-collected Valencia Sweet Orange (Citrus sinensis (L.) Osbeck) Citrus sinensis cDNA clone MVF-14_D10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF504150 ID=CF504150|Name=CF504150|organism=Citrus sinensis|type=EST|length=372bp
AGTTGACGCAGATCTCGAACTCGGCGTGAGAAAGGAAAGAAAAAAATGTC
AACTCGCTACATTCTCCTTCTCTCACTCACAATTCTCCTCTTATTCTCTC
CCGCTCTCGCCAAATCTCAAAACGACGCCGCTTCAGACGACGACGAAGAT
CTCAGCTTCCTCGAAGAAGCCGACCCCGATACCAAATCCAAAGCCGCATC
GCACCACCAGTTCGGCGAGAAGGATGGCGATCCAGACGACGATGACTTCT
CTGACGACTTCGACGACGAAAACTACCACGATTTCGACGACTCCGAGTAC
AAGGAGCCGGAGATCGATGACAAAGACGTCGTTGTTTTGAAGGAAAGGAA
TTTTAGTGATGTCATCGAGAAC
back to top